Lambda Red Protocol

Lambda Red Plasmids

These plasmids are available as part of the Wanner Lambda Red disruption kit from the E. coli Genetic Stock Center.

• pKD46 (ampR)
• pKD78 (camR)

Making Competent Cells expressing Lambda Red

Day 1

• Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C

Day 2

• Add 500uL of overnight culture to 30mL LB-Amp (or Cam).
• Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours)
• Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture).
• Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C.
• Spin cultures @ 1800 x g for 15 min to pellet cells.
• Resuspend pellet in 30 mL cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, resuspend in cold water.
  • cold 10% glycerol is also commonly used instead of water without incident.
• Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol.
• After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL.
• Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable.
• Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette.
• Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C.

Transforming Cells

• Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL)
• Transfer cells + DNA to a chilled gap cuvette
• Electroporate, recover immediately with 1mL SOC/SOB/LB.
• Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs.
• Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful.
• Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear.

NOTE Recover at 30°C if you intend on maintaining pKD46. Plasmid's origin does not function properly at 37°C.

Expected Results

The data below used 20ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30uL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55C annealing temperature, 25 cycles). Gel purify the 900bp band.

Primers

SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC

SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG

Location: Gottel stock primers, -20C freezer in MBB.

Strain: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB.

REL606

BW25113

References

1. Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97, 6640-6645.

Contributors

• Originally from Erik Quandt (6/7/2011)
• Edited by Steven Sowa (6/2011)
• Edited by -- Main.NeilGottel - 11 Sep 2012
• Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike