---++ Lambda Red Protocol ---++ Lambda Red Plasmids These plasmids are available as part of the [[http://cgsc.biology.yale.edu/GDK.php][Wanner Lambda Red disruption kit]] from the [[http://cgsc.biology.yale.edu][<i>E. coli</i> Genetic Stock Center]]. * pKD46 (ampR) * pKD78 (camR) ---++ Making Competent Cells expressing Lambda Red ---+++ Day 1 * Grow starter culture (of strain of interest with pKD46/pKD78) in 10mL LB-Amp or LB-Cam overnight at 30°C ---+++ Day 2 * Add 500uL of overnight culture to 30mL LB-Amp (or Cam). * Grow on 30C shaker until OD600 = ~ 0.350 - 0.400, (takes ~2-3 hours) * Induce cultures with filtered 10% Arabinose, creating a final concentration of 0.1% Arabinose (300uL of 10% Arabinose into the 30mL of culture). * Place back on 30°C shaker for 15 minutes, then transfer to 50mL falcon tube, and place on ice for 40 minutes. Start chilling centrifuge to 4°C. * Spin cultures @ 1800 x g for 15 min to pellet cells. * Resuspend pellet in 30 mL cold water. * cold 10% glycerol is also commonly used instead of water without incident. * Spin @ 3000 x g for 5 minutes, resuspend in cold water. * cold 10% glycerol is also commonly used instead of water without incident. * Spin @ 3000 x g for 5 minutes, and resuspend in cold 10% glycerol. * After this spin cycle, while pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move, then briefly vortex to resuspend the entire pellet, and transfer the entire remaining volume to a cold 15mL tube. Remaining volume will likely be between 10 to 3 mL. * Rebalance centrifuge, spin @ 3000 x g for 5 minutes. Pour off all glycerol, pellet should be stable. * Add back cold 10% glycerol for desired cell density, and number of elctroporations. Usually 300uL will yield a good cell density for ~6 electroporations. Resuspend pellet by pipetting with 1mL pipette. * Aliquot 50 uL cell suspensions into cold eppendorf tubes, store at -80°C. ---++ Transforming Cells * Add DNA to cell aliquots, typically 50-200ng (be sure to desalt, or use very low volumes of DNA i.e., 1uL) * Transfer cells + DNA to a chilled gap cuvette * Electroporate, recover immediately with 1mL SOC/SOB/LB. * Transfer to a culture tube with 10mL SOC/SOB/LB, place on 30°C shaker for 1.5 hrs. * Plate 100-200 uL of recovery onto selection plate (such as LB-Kan if using the Kan cassette from the keio collection). Leave the recovery culture on bench overnight, plate more next day if the initial plating was unsuccessful. * Grow the selection plate at 37°C overnight; Colonies may take a full 24 hours to appear. *NOTE* Recover at 30°C if you intend on maintaining pKD46. Plasmid's origin does not function properly at 37°C. ---+++ Expected Results The data below used 20ng of purified PCR product targeting the kan cassette from the topB keio strain, and 50uL of lambda-ready cells. To generate the insert, run a 30uL PCR using the primers below and genomic DNA from the topB keio strain under standard PCR conditions (55C annealing temperature, 25 cycles). Gel purify the 900bp band. *Primers* SWS_19: topB forward, GAGGTCAAAGCTACAGCCGCC SWS_20: topB reverse, ATACTTCTCGCTCCCAGGATGG Location: Gottel stock primers, -20C freezer in MBB. *Strain*: the topB keio strain is located in well P14 of the "33,35,37,39" plate in the keio collection rack, -80°C freezer in MBB. *REL606* %TABLE{headeralign="left,center,center,center,center,left" dataalign="center,center,center,center"}% | *Colonies on selective plate* | *Colonies on control plate* | *Dilution Factor* | *Recombination Efficiency* | | 5 | 65 | 10^5 | 7.7E-8 | | | 8 | 37 | 10^5 | 2.2E-7 | | | 7 | 53 | 10^5 | 1.3E-7 | | *BW25113* %TABLE{headeralign="left,center,center,center,center,left" dataalign="center,center,center,center"}% | *Colonies on selective plate* | *Colonies on control plate* | *Dilution Factor* | *Recombination Efficiency* | | 1 | 135 | 10^5 | 7.4E-9 | | | 1 | 152 | 10^5 | 6.6E-9 | | | 3 | 125 | 10^5 | 2.4E-8 | | ---+++ References 1 Datsenko, K.A. & Wanner, B.L. (2000). One-step inactivation of chromosomal genes in _Escherichia coli_ K-12 using PCR products. _Proc. Natl. Acad. Sci. USA_ *97*, 6640-6645. ---+++ Contributors * Originally from Erik Quandt (6/7/2011) * Edited by Steven Sowa (6/2011) * Edited by -- Main.NeilGottel - 11 Sep 2012 * Edited by DED (4/3/13) -- comment on use of glycerol rather than water after conversation with Lindsey and Mike
This topic: Lab
>
WebHome
>
ProtocolList
>
ProcedureGenomeModificationDatsenkoWanner
Topic revision: r7 - 2013-09-21 - JeffreyBarrick
Copyright ©2025 Barrick Lab contributing authors. Ideas, requests, problems?
Send feedback