---+ Megaprimer whole plasmid cloning aka <nop>MEGAWHOP cloning %BR% aka Overlap Extension PCR cloning Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. _Biotechniques_.48(6):463-5. ---++ Purpose To insert a DNA sequence into a plasmid without restriction enzymes. ---++ Experimental Steps * Create primers that amplify region of interest and hybridize with target plasmid * Perform a Phusion PCR with primers using the region of interest as template * Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template * Digest Second PCR with Dpn1 to remove parental plasmid * Transform in _E coli_ <img width="763" alt="genome_mod_figure.JPG" src="%ATTACHURLPATH%/genome_mod_figure.JPG" height="146" /> ---++ Designing Primers <img width="374" alt="primers.png" src="%ATTACHURLPATH%/primers.png" height="204" /> Primers need to have two components * a region that amplifies the insert (A(or B), 20-25nt) * a region that targets the new plasmid (C(or D), 30-40nt) The target plasmid regions should preferably be 50-200nt apart (C to D). Order (A+C) primer and (B+D) primer. ---++ PCR Insert Use standard 25ul Phusion (or other high fidelity polymerase) protocol * PCR 1(25ul reaction) * 5 ul 5x Buffer * 1.5 ul dntps * 1.25 ul primer (A+C) * 1.25 ul primer (B+D) * x ul template plasmid (<250ng) * ddH20 to 24.5 ul * then add 0.5 ul Phusion Set elongation time according to size of insert. Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture. ---++ PCR Recombinant Plasmid Use modified 10ul Phusion (or other high fidelity polymerase) protocol * 2 ul 5x Buffer * 1 ul dntps * 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid). * ~10 ng target plasmid * ddH20 to 9.5 ul * then add 0.5 ul Phusion Adjust Elongation time for the length of the entire plasmid (90 seconds per kb). OR Use modified 25ul Phusion protocol * 5 ul 5x Buffer * 0.5 ul dntps * 1 ul DMSO * 100 ng PCR insert product * 25 ng target plasmid * ddH20 to 25 ul * then add 0.25 ul Phusion 68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb). ---++ Digest Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. [[ProtocolsDpnIDigestion][DpnI Digest]] ---++ Transform Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent _E coli_. ---++ Example Change the promoter for sgRNA using MegaWHOP. Template sequence: https://benchling.com/s/g4S95i24 Primers: * T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3' * T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3' UPCASE LETTERS: a region that amplifies the insert (A(or B) lower case letters: a region that targets the new plasmid (C(or D) *PCR MEGA_primer: <br /> <img width="277" alt="MEGA_primer.png" src="%ATTACHURLPATH%/MEGA_primer.png" height="241.5" /> *PCR Recombinant Plasmid: <br /> <img width="222" alt="Recombinant_Plasmid.png" src="%ATTACHURLPATH%/Recombinant_Plasmid.png" height="235.2" />
This topic: Lab
>
WebHome
>
ProtocolList
>
MEGAWHOPAND238=68AND6TAJ=6TAJ
Topic revision: r10 - 2017-06-13 - GabrielSuarez
Copyright © 2008-2025 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki?
Send feedback