Difference: MEGAWHOP (1 vs. 12)

Revision 122018-10-25 - SeanLeonard

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

Changed:
<
<
aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
>
>
aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
Added:
>
>
We describe two approaches to MEGAWHOP in this protocol page.
 
Added:
>
>

Approach 1:

 Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use standard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

OR

Use modified 25ul Phusion protocol

  • 5 ul 5x Buffer
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
  • ddH20 to 25 ul
  • then add 0.25 ul Phusion

68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.

Example

Change the promoter for sgRNA using MegaWHOP.

Template sequence: https://benchling.com/s/g4S95i24

Primers:

  • T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
  • T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'

UPCASE LETTERS: a region that amplifies the insert (A(or B)

lower case letters: a region that targets the new plasmid (C(or D)

*PCR MEGA_primer:
MEGA_primer.png

*PCR Recombinant Plasmid:
Recombinant_Plasmid.png

Added:
>
>

Approach 2:

Introduction

This protocol was inspired (after failed site directed mutagenesis attempts using Quikchange) by the protocol listed here at the Colgate website here. There are several other method papers that describe this (or variant) MEGAPRIMER and MEGAWHOP protocols, there is one here and the original here.

This technique is useful for introducing single base pair, single amino acid, or multiple changes into a gene residing on a plasmid that you already have. In short, one mutagenic primer is paired with a standard primer to create a “Megaprimer” product that contains your mutation(s) of choice, is 200-400 bp long, and contains at least >=15 bp of homology on each end to your template plasmid. (You could, of course, just order a gene block with of this size containing all of your desired mutations and use it as a megaprimer). This megaprimer is purified and then used as primer with the template plasmid in a second PCR whole plasmid (Megawhop) reaction. This PCR product is cleaned up and transformed into competent cells to yield your desired mutation.

Required Materials

Template Plasmid
Competent Cells
PCR Reagents
Culturing Materials (>= 4 plates with appropriate antibiotics for transformations)
Sequence of desired mutation
Primer Upstream of Desired mutation

Procedure

1. Design a mutagenic primer with your desired mutation. Ensure at least 15 base pairs of homology downstream of your mutation.
2. Create your megaprimer by running PCR using your upstream primer and designed primer with a standard Phusion protocol. Your template is your unmutated gene product. 2x 50 uL reactions are sufficient. This megaprimer will contain your desired mutations.

These steps have worked:

  • Denature at 98 deg for 1 min.
  • 30 cycles of:
    • 98 deg for 30 sec
    • 62 deg for 30 sec
    • 72 deg for 15 sec
  • 72 deg for 5 min

3. Confirm your PCR was successful with a DNA agarose gel and gel purify your 200-400bp product. Elute with a small volume (20 uL).
4. Use this purified megaprimer product and your template plasmid in a 2nd PCR (2x 50 uL reactions). Your control in this reaction is a reaction without your megaprimer from the previous step. Use commercial Phusion for this reaction (or other super high fidelity polymerase). Each tube should contain very little template plasmid (1 uL or 50 ng) and 5 uL of your purified megaprimer product. Concentrations for the rest of your PCR reagents are standard.
These steps have worked:

  • Denature at 98 deg for 2 min
  • 30 cycles of:
    • 98 deg for 1 min
    • 62 deg for 30 sec
    • 72 deg for 3 min (based on a plasmid size of 5kb, you should adjust accordingly)
  • 72 deg for 5 min
5. Add 1 uL DpnI to each tube to digest your template plasmid.
6. Optional You can run 5uL of your completed PCR reaction on an agarose gel and compare it to (1) your control reaction and (2)an unreacted mixture of the PCR components. You should see a faint band at your expected plasmid size only in your primer-containing reaction (DpnI should digest the template in both reactions).
7. PCR Cleanup both your sample and control reactions.
8. Transform 1-2uL of each reaction into competent cells using standard electroporation or chemical transformation protocols.
9. Plate dilutions of both reactions on appropriate antibiotic plates for selection.
10. If your sample shows more colonies than your control, the process was likely successful. Pick 3 clones to make stocks and send for sequencing (link)
 
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="MEGA_primer.png" attr="h" comment="" date="1481836218" name="MEGA_primer.png" path="MEGA_primer.png" size="71929" stream="MEGA_primer.png" tmpFilename="/usr/tmp/CGItemp40125" user="PengGeng" version="1"
META FILEATTACHMENT attachment="Recombinant_Plasmid.png" attr="h" comment="" date="1481836534" name="Recombinant_Plasmid.png" path="Recombinant_Plasmid.png" size="87615" stream="Recombinant_Plasmid.png" tmpFilename="/usr/tmp/CGItemp40185" user="PengGeng" version="1"

Revision 112017-12-14 - PengGeng

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

Changed:
<
<
aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
>
>
aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
  Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

Deleted:
<
<
To insert a DNA sequence into a plasmid without restriction enzymes.
 
Added:
>
>
To insert a DNA sequence into a plasmid without restriction enzymes.
 

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Changed:
<
<
Use standard 25ul Phusion (or other high fidelity polymerase) protocol
>
>
Use standard 25ul Phusion (or other high fidelity polymerase) protocol
 
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Changed:
<
<
Use modified 10ul Phusion (or other high fidelity polymerase) protocol
>
>
Use modified 10ul Phusion (or other high fidelity polymerase) protocol
 
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

OR

Use modified 25ul Phusion protocol

  • 5 ul 5x Buffer
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
  • ddH20 to 25 ul
  • then add 0.25 ul Phusion

68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

Digest

Changed:
<
<
Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest
>
>
Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest
 

Transform

Changed:
<
<
Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.
>
>
Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.
 

Example

Changed:
<
<
Change the promoter for sgRNA using MegaWHOP.
>
>
Change the promoter for sgRNA using MegaWHOP.
  Template sequence: https://benchling.com/s/g4S95i24

Primers:

  • T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
  • T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'

UPCASE LETTERS: a region that amplifies the insert (A(or B)

lower case letters: a region that targets the new plasmid (C(or D)

*PCR MEGA_primer:
MEGA_primer.png

*PCR Recombinant Plasmid:
Recombinant_Plasmid.png

META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="MEGA_primer.png" attr="h" comment="" date="1481836218" name="MEGA_primer.png" path="MEGA_primer.png" size="71929" stream="MEGA_primer.png" tmpFilename="/usr/tmp/CGItemp40125" user="PengGeng" version="1"
META FILEATTACHMENT attachment="Recombinant_Plasmid.png" attr="h" comment="" date="1481836534" name="Recombinant_Plasmid.png" path="Recombinant_Plasmid.png" size="87615" stream="Recombinant_Plasmid.png" tmpFilename="/usr/tmp/CGItemp40185" user="PengGeng" version="1"

Revision 102017-06-13 - GabrielSuarez

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

Changed:
<
<
aka MEGAWHOP cloning
>
>
aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
Deleted:
<
<
aka Overlap Extension PCR cloning
  Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli
Changed:
<
<
genome_mod_figure.JPG
>
>
genome_mod_figure.JPG
 
Deleted:
<
<
 

Designing Primers

Changed:
<
<
primers.png
>
>
primers.png
  Primers need to have two components
  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Changed:
<
<
Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
>
>
Use standard 25ul Phusion (or other high fidelity polymerase) protocol
 
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
Changed:
<
<
  • 1.5 ul dntps
>
>
  • 1.5 ul dntps
 
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
Changed:
<
<
  • x ul template plasmid (<250ng)
>
>
  • x ul template plasmid (<250ng)
 
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Changed:
<
<
Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.
>
>
Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.
 

PCR Recombinant Plasmid

Changed:
<
<
Use modified 10ul Phusion (or other high fidelity polymerase) protocol
>
>
Use modified 10ul Phusion (or other high fidelity polymerase) protocol
 
  • 2 ul 5x Buffer
Changed:
<
<
  • 1 ul dntps
>
>
  • 1 ul dntps
 
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
Changed:
<
<
  • ~10 ng target plasmid
>
>
  • ~10 ng target plasmid
 
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion
Changed:
<
<
Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).
>
>
Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).
  OR
Changed:
<
<
>
>
Use modified 25ul Phusion protocol
Deleted:
<
<
Use modified 25ul Phusion protocol
 
  • 5 ul 5x Buffer
Changed:
<
<
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
>
>
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
 
  • ddH20 to 25 ul
  • then add 0.25 ul Phusion
Changed:
<
<
68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min
>
>
68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).
Deleted:
<
<
Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).
 
Changed:
<
<

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest
>
>

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest
 

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.
Deleted:
<
<
 

Example

Change the promoter for sgRNA using MegaWHOP.

Template sequence: https://benchling.com/s/g4S95i24

Changed:
<
<
Primers:
>
>
Primers:
 
  • T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
Changed:
<
<
  • T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'
>
>
  • T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'
  UPCASE LETTERS: a region that amplifies the insert (A(or B)
Changed:
<
<
lower case letters: a region that targets the new plasmid (C(or D)
>
>
lower case letters: a region that targets the new plasmid (C(or D)
 
Changed:
<
<
*PCR MEGA_primer:
>
>
*PCR MEGA_primer:
MEGA_primer.png
Deleted:
<
<
MEGA_primer.png
 
Changed:
<
<
*PCR Recombinant Plasmid:
>
>
*PCR Recombinant Plasmid:
Recombinant_Plasmid.png
Deleted:
<
<
Recombinant_Plasmid.png

 
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="MEGA_primer.png" attr="h" comment="" date="1481836218" name="MEGA_primer.png" path="MEGA_primer.png" size="71929" stream="MEGA_primer.png" tmpFilename="/usr/tmp/CGItemp40125" user="PengGeng" version="1"
META FILEATTACHMENT attachment="Recombinant_Plasmid.png" attr="h" comment="" date="1481836534" name="Recombinant_Plasmid.png" path="Recombinant_Plasmid.png" size="87615" stream="Recombinant_Plasmid.png" tmpFilename="/usr/tmp/CGItemp40185" user="PengGeng" version="1"

Revision 92016-12-15 - PengGeng

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

OR

Use modified 25ul Phusion protocol

  • 5 ul 5x Buffer
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
  • ddH20 to 25 ul
  • then add 0.25 ul Phusion

68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.

Added:
>
>

Example

Change the promoter for sgRNA using MegaWHOP.
 
Added:
>
>
Template sequence: https://benchling.com/s/g4S95i24

Primers:

  • T5-sgRNA-F: 5' CCGATAATTGCAGACGAACG cgcccttcccaacagttgcc3'
  • T5-sgRNA-R:5' TATTCTGGTGGAACTGGATG tgaatctattataattgtt 3'

UPCASE LETTERS: a region that amplifies the insert (A(or B)

lower case letters: a region that targets the new plasmid (C(or D)

*PCR MEGA_primer:
MEGA_primer.png

*PCR Recombinant Plasmid:
Recombinant_Plasmid.png

 
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
Added:
>
>
META FILEATTACHMENT attachment="MEGA_primer.png" attr="h" comment="" date="1481836218" name="MEGA_primer.png" path="MEGA_primer.png" size="71929" stream="MEGA_primer.png" tmpFilename="/usr/tmp/CGItemp40125" user="PengGeng" version="1"
META FILEATTACHMENT attachment="Recombinant_Plasmid.png" attr="h" comment="" date="1481836534" name="Recombinant_Plasmid.png" path="Recombinant_Plasmid.png" size="87615" stream="Recombinant_Plasmid.png" tmpFilename="/usr/tmp/CGItemp40185" user="PengGeng" version="1"
 

Revision 82016-04-29 - PengGeng

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

Added:
>
>
OR

Use modified 25ul Phusion protocol

  • 5 ul 5x Buffer
  • 0.5 ul dntps
  • 1 ul DMSO
  • 100 ng PCR insert product
  • 25 ng target plasmid
  • ddH20 to 25 ul
  • then add 0.25 ul Phusion

68°C 5min+98°C 3min+(98°C 30s+68°C 30s+72°C X min)*30 +72°C 10min Adjust Elongation time for the length of the entire plasmid (30 seconds per kb).

 

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.

META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"

Revision 72014-07-21 - SeanLeonard

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

Digest

Changed:
<
<
Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA.
>
>
Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA. DpnI Digest
 

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.

META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"

Revision 62014-06-16 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
Deleted:
<
<
Steve Sowa

4/25/2012

 Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA.

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.
Deleted:
<
<

-- Main.SteveSowa - 25 Apr 2012

 

META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"

Revision 52013-09-09 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Steve Sowa

4/25/2012

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert.

Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).

Digest

Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA.

Transform

Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.

-- Main.SteveSowa - 25 Apr 2012

META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
Changed:
<
<
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
>
>
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="h" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
 

Revision 42012-05-01 - BrianRenda

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Steve Sowa

4/25/2012

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

genome_mod_figure.JPG

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion
Changed:
<
<
Set elongation time according to size of insert
>
>
Set elongation time according to size of insert.
 
Changed:
<
<
Purify PCR products
>
>
Purify PCR products. This can either be done through a gel extraction or by adding Dpn1 directly to the Phusion reaction mixture after PCR, digesting at 37°C for 1 hour, and then doing a standard PCR clean up. Dpn1 works efficiently in a Phusion reaction mixture.
 

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
Changed:
<
<
  • 500 ng PCR insert product
>
>
  • 500 ng PCR insert product (Note, for optimal results, have a 250-fold molar excess of your megaprimer to your target plasmid).
 
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion
Changed:
<
<
Adjust Elongation time for the length of the entire plasmid
>
>
Adjust Elongation time for the length of the entire plasmid (90 seconds per kb).
 

Digest

Changed:
<
<
Digest Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA
>
>
Once the reaction is complete, digest the Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA.
 

Transform

Changed:
<
<
Electroporate the new plasmid into E coli
>
>
Heatshock 5ul of the Dpn1-digested MEGAWHOP reaction mixture into 25ul of chemically competent E coli.
 

-- Main.SteveSowa - 25 Apr 2012

Deleted:
<
<
 
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"

Revision 32012-04-30 - SteveSowa

 
META TOPICPARENT name="ProtocolList"

Megaprimer whole plasmid cloning

aka MEGAWHOP cloning
aka Overlap Extension PCR cloning

Steve Sowa

4/25/2012

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli
Added:
>
>
genome_mod_figure.JPG
 
Deleted:
<
<
model.png
 

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert

Purify PCR products

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid

Digest

Digest Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA

Transform

Electroporate the new plasmid into E coli

-- Main.SteveSowa - 25 Apr 2012

Changed:
<
<
META FILEATTACHMENT attachment="model.png" attr="h" comment="" date="1335381026" name="model.png" path="model.png" size="9878" stream="model.png" tmpFilename="/usr/tmp/CGItemp25582" user="SteveSowa" version="1"
>
>
 
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
Added:
>
>
META FILEATTACHMENT attachment="genome_mod_figure.JPG" attr="" comment="" date="1335815084" name="genome_mod_figure.JPG" path="genome_mod_figure.JPG" size="20694" stream="genome_mod_figure.JPG" tmpFilename="/usr/tmp/CGItemp36507" user="SteveSowa" version="1"
 

Revision 22012-04-26 - JeffreyBarrick

 
META TOPICPARENT name="ProtocolList"
Changed:
<
<

MEGAWHOP

>
>

Megaprimer whole plasmid cloning

Added:
>
>
aka MEGAWHOP cloning
aka Overlap Extension PCR cloning
 Steve Sowa

4/25/2012

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

model.png

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert

Purify PCR products

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid

Digest

Digest Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA

Transform

Electroporate the new plasmid into E coli

-- Main.SteveSowa - 25 Apr 2012

META FILEATTACHMENT attachment="model.png" attr="h" comment="" date="1335381026" name="model.png" path="model.png" size="9878" stream="model.png" tmpFilename="/usr/tmp/CGItemp25582" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"

Revision 12012-04-25 - SteveSowa

 
META TOPICPARENT name="ProtocolList"

MEGAWHOP

Steve Sowa

4/25/2012

Adapted from Bryksin AV, Matsumura I. 2010. Overlap extension PCR Cloning: a simple and reliable way to create recombinant plasmids. Biotechniques.48(6):463-5.

Purpose

To insert a DNA sequence into a plasmid without restriction enzymes.

Experimental Steps

  • Create primers that amplify region of interest and hybridize with target plasmid
  • Perform a Phusion PCR with primers using the region of interest as template
  • Perform a second Phusion PCR using the products of the first PCR and the target plasmid as template
  • Digest Second PCR with Dpn1 to remove parental plasmid
  • Transform in E coli

model.png

Designing Primers

primers.png

Primers need to have two components

  • a region that amplifies the insert (A(or B), 20-25nt)
  • a region that targets the new plasmid (C(or D), 30-40nt)

The target plasmid regions should preferably be 50-200nt apart (C to D).

Order (A+C) primer and (B+D) primer.

PCR Insert

Use stardard 25ul Phusion (or other high fidelity polymerase) protocol
  • PCR 1(25ul reaction)
  • 5 ul 5x Buffer
  • 1.5 ul dntps
  • 1.25 ul primer (A+C)
  • 1.25 ul primer (B+D)
  • x ul template plasmid (<250ng)
  • ddH20 to 24.5 ul
  • then add 0.5 ul Phusion

Set elongation time according to size of insert

Purify PCR products

PCR Recombinant Plasmid

Use modified 10ul Phusion (or other high fidelity polymerase) protocol
  • 2 ul 5x Buffer
  • 1 ul dntps
  • 500 ng PCR insert product
  • ~10 ng target plasmid
  • ddH20 to 9.5 ul
  • then add 0.5 ul Phusion

Adjust Elongation time for the length of the entire plasmid

Digest

Digest Recombinant Plasmid PCR product with 0.5 ul Dpn1 at 37°C for one and a half hours to remove parental DNA

Transform

Electroporate the new plasmid into E coli

-- Main.SteveSowa - 25 Apr 2012

META FILEATTACHMENT attachment="model.png" attr="h" comment="" date="1335381026" name="model.png" path="model.png" size="9878" stream="model.png" tmpFilename="/usr/tmp/CGItemp25582" user="SteveSowa" version="1"
META FILEATTACHMENT attachment="primers.png" attr="h" comment="" date="1335381623" name="primers.png" path="primers.png" size="2306" stream="primers.png" tmpFilename="/usr/tmp/CGItemp25484" user="SteveSowa" version="1"
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright ©2026 Barrick Lab contributing authors. Ideas, requests, problems? Send feedback